Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249373

Morpholino Name: dhcr7 MO2
Synonyms: DHCR7a-MO
Target mRNA: dhcr7

Morpholino Type: uncategorized morpholino
Sequence: 5' TCTGCTCTTTGTGTTCTGCTTATCT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 22/25
genome
MO
5' AGATAAGCAGAACACAAAGAGGTAA 3'
   |||||||||||||||||||||   |
3' TCTATTCGTCTTGTGTTTCTCGTCT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:3411603..3411627 22/25 Antisense target dhcr7.L
Chr1L:21930238..21930262 22/25 Sense off-target nsd2.L
Chr2S:50633118..50633142 21/25 Antisense off-target rpgr.S
Chr5L:135192508..135192532 21/25 Sense off-target hdlbp.L
Chr1L:68220529..68220553 21/25 Antisense off-target larp1b.L
Chr7L:73826493..73826517 21/25 Sense off-target LOC121395536
Chr9_10S:111567373..111567397 21/25 Antisense off-target LOC108702348
Chr2S:95335690..95335714 21/25 Antisense unknown
Chr3L:16938058..16938082 21/25 Antisense unknown
Chr5L:153566860..153566884 21/25 Antisense unknown
Chr6L:143406065..143406089 21/25 Antisense unknown
Chr6L:29229740..29229764 21/25 Sense unknown
Chr2L:140338251..140338275 21/25 Sense unknown
tropicalis 10.0 Chr8:139965545..139965569 21/25 Antisense unknown
Chr8:90035525..90035549 21/25 Sense unknown
Publications
First: Negative regulation of Hedgehog signaling by the cholesterogenic enzyme 7-dehydrocholesterol reductase., Development 2006                  
Most recent:
View All Papers