Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249372

Morpholino Name: dhcr7 MO1
Synonyms: DHCR7b-MO
Target mRNA: dhcr7

Morpholino Type: uncategorized morpholino
Sequence: 5' GTCCCCAGCAGCTCTCCCCATGTAG 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 25/25 22/25
genome
MO
5' CTACATGGGGAGAGCTGCTGGGGAC 3'
   |||||||||||||||||||||||||
3' GATGTACCCCTCTCGACGACCCCTG 5'
5' CTGCATGGGGACAGCTGCTGGGGCC 3'
   || |||||||| ||||||||||| |
3' GATGTACCCCTCTCGACGACCCCTG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:3411578..3411602 25/25 Antisense target dhcr7.L
Chr4S:20377446..20377470 22/25 Sense target dhcr7.S
Chr5S:138489446..138489470 21/25 Antisense off-target fzd3.S
tropicalis 10.0 Chr5:129546608..129546632 21/25 Antisense off-target tfdp2
Chr3:136190843..136190867 21/25 Antisense unknown
Publications
First: Negative regulation of Hedgehog signaling by the cholesterogenic enzyme 7-dehydrocholesterol reductase., Development 2006                  
Most recent:
View All Papers