Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249371

Morpholino Name: dgcr8 MO1
Synonyms: Dgcr8-MO
Target mRNA: dgcr8

Morpholino Type: uncategorized morpholino
Sequence: 5' GGGCTACTTCCTCACACTCCTCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 25/25
genome
MO
5' ATGGAGGAGTGTGAGGAAGTAGCCC 3'
   |||||||||||||||||||||||||
3' TACCTCCTCACACTCCTTCATCGGG 5'
5' ATGGAGGAGTGTGAGGAAGTAGCCC 3'
   |||||||||||||||||||||||||
3' TACCTCCTCACACTCCTTCATCGGG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:168698127..168698151 25/25 Antisense target dgcr8.L
Chr1L:168657730..168657754 25/25 Antisense off-target LOC108716057
Chr6S:36540481..36540505 21/25 Sense off-target LOC108719943
Chr1S:105105458..105105482 21/25 Antisense unknown
Chr1S:105113660..105113684 21/25 Antisense unknown
tropicalis 10.0 Chr1:155330643..155330667 25/25 Antisense target dgcr8
Chr1:208035767..208035791 21/25 Sense unknown
Publications
First: The miR-30 miRNA family regulates Xenopus pronephros development and targets the transcription factor Xlim1/Lhx1., Development 2009                
Most recent: MiR-142-3p controls the specification of definitive hemangioblasts during ontogeny., Dev Cell 2013                      
View All Papers