Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249370

Morpholino Name: desi2 MO1
Synonyms: xPNAS-4 MO
Target mRNA: desi2

Morpholino Type: uncategorized morpholino
Sequence: 5' TCTCCTCCTCCTCCTGAGAATATCC 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' GGATATTCTCAGGAGGAGGAGGAGA 3'
   |||||||||||||||||||||||||
3' CCTATAAGAGTCCTCCTCCTCCTCT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:44829326..44829350 25/25 Antisense target desi2.L
Chr3S:128369381..128369405 22/25 Antisense off-target LOC108703417
Chr2L:31460353..31460377 21/25 Sense off-target nsrp1.L
Chr2L:90935046..90935070 21/25 Antisense off-target adgrb2.L
Chr5L:102582000..102582024 21/25 Antisense off-target LOC108716186
Chr1L:6880167..6880191 21/25 Antisense unknown
Chr2L:170644517..170644541 21/25 Sense unknown
Chr5S:5051661..5051685 21/25 Antisense unknown
tropicalis 10.0 Chr1:735422..735446 21/25 Antisense off-target nop56
Chr3:123125813..123125837 21/25 Antisense off-target rassf2
Publications
First: Identification, characterization, and effects of Xenopus laevis PNAS-4 gene on embryonic development., J Biomed Biotechnol 2010            
Most recent:
View All Papers