Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249369

Morpholino Name: ddit3 MO2
Synonyms: XCHOP MO2
Target mRNA: ddit3

Morpholino Type: uncategorized morpholino
Sequence: 5' AGACTCTGCCATCATTTTGTAGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/23 21/23 20/23
genome
MO
5' CATACAAAATGATGGCAGAGTCT 3'
     |||||||||||||||||||||
3' TGATGTTTTACTACCGTCTCAGA 5'
5' CATACAAAATGATGGCAGAGTCT 3'
     |||||||||||||||||||||
3' TGATGTTTTACTACCGTCTCAGA 5'
5' CATACAAAATGATGGCAGAATCT 3'
     ||||||||||||||||| |||
3' TGATGTTTTACTACCGTCTCAGA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:147907115..147907137 21/23 Sense target ddit3.L
Chr2S:132293633..132293655 20/23 Sense target ddit3.S
Chr3S:55438364..55438386 19/23 Antisense off-target thsd4.S
Chr4L:70025014..70025036 19/23 Sense off-target cnot1.L
Chr4S:55759339..55759361 19/23 Antisense off-target cnot1.S
Chr1S:167999906..167999928 20/23 Sense unknown
Chr6S:87197588..87197610 20/23 Antisense unknown
Chr2L:106217824..106217846 19/23 Antisense unknown
Chr2L:146174584..146174606 19/23 Antisense unknown
Chr2S:31987841..31987863 19/23 Sense unknown
Chr5L:47841838..47841860 19/23 Antisense unknown
Chr9_10L:31544750..31544772 19/23 Sense unknown
Chr2L:102023922..102023944 19/23 Antisense unknown
tropicalis 10.0 Chr2:140582984..140583006 21/23 Sense target ddit3
Publications
First: The C/EBP homologous protein CHOP (GADD153) is an inhibitor of Wnt/TCF signals., Oncogene 2006  
Most recent:
View All Papers