Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249368

Morpholino Name: ddit3 MO1
Synonyms: XCHOP MO1
Target mRNA: ddit3

Morpholino Type: uncategorized morpholino
Sequence: 5' GCCATCATTTTGTATGGCAATCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/23 23/23 23/23
genome
MO
5' AGATTGCCATACAAAATGATGGC 3'
   |||||||||||||||||||||||
3' TCTAACGGTATGTTTTACTACCG 5'
5' AGATTGCCATACAAAATGATGGC 3'
   |||||||||||||||||||||||
3' TCTAACGGTATGTTTTACTACCG 5'
5' AGATTGCCATACAAAATGATGGC 3'
   |||||||||||||||||||||||
3' TCTAACGGTATGTTTTACTACCG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2S:132293640..132293662 23/23 Sense target ddit3.S
Chr2L:147907122..147907144 23/23 Sense target ddit3.L
Chr1L:41482394..41482416 20/23 Antisense off-target lnx1.L
Chr9_10L:114872423..114872445 20/23 Sense off-target ankfn1l.L
Chr3S:48566527..48566549 20/23 Sense off-target adamtsl3.S
Chr3S:48566527..48566549 20/23 Sense off-target LOC121402157
Chr6S:70267672..70267694 19/23 Antisense off-target cdh6.S
Chr2S:77207958..77207980 19/23 Antisense off-target grik3.S
Chr6L:17488055..17488077 19/23 Sense off-target zmynd11.L
Chr1S:45511253..45511275 19/23 Antisense off-target LOC108704343
Chr4S:44349443..44349465 19/23 Sense off-target LOC108715436
Chr2S:89147760..89147782 20/23 Antisense unknown
Chr1S:5967978..5968000 19/23 Antisense unknown
Chr2L:58800788..58800810 19/23 Antisense unknown
Chr3S:104210248..104210270 19/23 Sense unknown
Chr7L:101034469..101034491 19/23 Sense unknown
Chr8L:30692595..30692617 19/23 Antisense unknown
tropicalis 10.0 Chr2:140582991..140583013 23/23 Sense target ddit3
Chr1:23800115..23800137 19/23 Sense off-target cpz
Chr4:127914711..127914733 19/23 Sense off-target nprl2
Chr2:79761142..79761164 20/23 Sense unknown
Chr3:126797114..126797136 19/23 Antisense unknown
Publications
First: The C/EBP homologous protein CHOP (GADD153) is an inhibitor of Wnt/TCF signals., Oncogene 2006  
Most recent:
View All Papers