Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249367

Morpholino Name: dcc MO2
Synonyms: dcc MO
Target mRNA: dcc

Morpholino Type: uncategorized morpholino
Sequence: 5' ATCCAAGACAATTCTCCATATTTCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 24/25 25/25
genome
MO
5' TGAAATATGGAGAATAGTCTTGGAT 3'
   ||||||||||||||| |||||||||
3' ACTTTATACCTCTTAACAGAACCTA 5'
5' TGAAATATGGAGAATTGTCTTGGAT 3'
   |||||||||||||||||||||||||
3' ACTTTATACCTCTTAACAGAACCTA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1S:192416800..192416824 25/25 Sense target dcc.S
Chr4S:56193355..56193379 22/25 Antisense off-target sf3b3.S
Chr1L:222117416..222117440 25/25 Sense unknown
Chr7S:26746449..26746473 22/25 Sense unknown
Chr5L:155242896..155242920 21/25 Sense unknown
Chr5L:90111530..90111554 21/25 Antisense unknown
Chr5S:74055544..74055568 21/25 Sense unknown
Chr6L:28524237..28524261 21/25 Antisense unknown
Chr7L:99877488..99877512 21/25 Antisense unknown
tropicalis 10.0 Chr1:204368498..204368522 24/25 Sense target dcc
Chr4:16967921..16967945 21/25 Sense off-target spon1
Chr4:21889491..21889515 21/25 Sense unknown
Publications
First: DSCAM is a netrin receptor that collaborates with DCC in mediating turning responses to netrin-1., Cell 2008  
Most recent:
View All Papers