Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249366

Morpholino Name: dcc MO1
Synonyms: XDCC-MO, xDCC
Target mRNA: dcc

Morpholino Type: uncategorized morpholino
Sequence: 5' CCAAGACAATTCTCCATATTTCAGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 24/25 25/25
genome
MO
5' GCTGAAATATGGAGAATAGTCTTGG 3'
   ||||||||||||||||| |||||||
3' CGACTTTATACCTCTTAACAGAACC 5'
5' GCTGAAATATGGAGAATTGTCTTGG 3'
   |||||||||||||||||||||||||
3' CGACTTTATACCTCTTAACAGAACC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1S:192416802..192416826 25/25 Sense target dcc.S
Chr9_10L:57469157..57469181 21/25 Sense off-target mylk.L
Chr4S:105567156..105567180 21/25 Antisense off-target sema3f.S
Chr2L:24793954..24793978 21/25 Sense off-target LOC108707903
Chr1L:222117418..222117442 25/25 Sense unknown
Chr5S:74055546..74055570 21/25 Sense unknown
Chr7L:99877486..99877510 21/25 Antisense unknown
Chr7S:26746451..26746475 21/25 Sense unknown
tropicalis 10.0 Chr1:204368500..204368524 24/25 Sense target dcc
Chr1:199128998..199129022 21/25 Sense off-target prlr
Chr2:25699559..25699583 21/25 Sense unknown
Publications
First: Peptidyl-prolyl isomerase FKBP52 controls chemotropic guidance of neuronal growth cones via regulation of TRPC1 channel opening., Neuron 2009  
Most recent:
View All Papers