Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249365

Morpholino Name: dbx2 MO1
Synonyms: XDbx2 MO
Target mRNA: dbx2

Morpholino Type: uncategorized morpholino
Sequence: 5' ACTTCTGATTCTGGTCTGGCTCCTA 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' TAGGAGCCAGACCAGAATCAGAAGT 3'
   |||||||||||||||||||||||||
3' ATCCTCGGTCTGGTCTTAGTCTTCA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:70675913..70675937 25/25 Antisense target dbx2.L
Chr9_10S:92374125..92374149 22/25 Antisense off-target LOC121399085
Chr7S:28541076..28541100 21/25 Antisense off-target pik3ap1.S
Chr7S:57268440..57268464 22/25 Sense unknown
Chr5S:59292971..59292995 21/25 Sense unknown
Chr7S:60110834..60110858 21/25 Sense unknown
Chr3L:6762920..6762944 21/25 Antisense unknown
tropicalis 10.0 Chr5:74901525..74901549 21/25 Sense unknown
Publications
First: Xenopus Dbx2 is involved in primary neurogenesis and early neural plate patterning., Biochem Biophys Res Commun 2011              
Most recent:
View All Papers