Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249364

Morpholino Name: dbx1 MO1
Synonyms: XDbx1 MO
Target mRNA: dbx1

Morpholino Type: uncategorized morpholino
Sequence: 5' GAGCTAAGAGGCTTGGGAACATCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/24 23/24 24/24
genome
MO
5' TGATGTTCCCAAGCCTGTTAGCCC 3'
   |||||||||||||||| ||||| |
3' ACTACAAGGGTTCGGAGAATCGAG 5'
5' TGATGTTCCCAAGCCTCTTAGCCC 3'
   |||||||||||||||||||||| |
3' ACTACAAGGGTTCGGAGAATCGAG 5'
5' TGATGTTCCCAAGCCTCTTAGCTC 3'
   ||||||||||||||||||||||||
3' ACTACAAGGGTTCGGAGAATCGAG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4S:21002298..21002321 24/24 Sense target dbx1.S
Chr4L:2814989..2815012 23/24 Antisense target dbx1.L
tropicalis 10.0 Chr4:4534209..4534232 22/24 Antisense target dbx1
Chr2:84298367..84298390 20/24 Sense unknown
Publications
First: Xenopus Dbx2 is involved in primary neurogenesis and early neural plate patterning., Biochem Biophys Res Commun 2011              
Most recent: Prdm12 specifies V1 interneurons through cross-repressive interactions with Dbx1 and Nkx6 genes in Xenopus., Development 2015                                      
View All Papers