Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249363

Morpholino Name: dbf4 MO2
Synonyms: XDMO1
Target mRNA: dbf4

Morpholino Type: uncategorized morpholino
Sequence: 5' CACTGCTGCTATGGTAGATTTCATT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 24/25
genome
MO
5' AATGAAATCTACCGTAGCAGCAGTG 3'
   ||||||||||||| |||||||||||
3' TTACTTTAGATGGTATCGTCGTCAC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:28947261..28947285 24/25 Sense target dbf4.L
Chr8S:15128709..15128733 22/25 Antisense unknown
tropicalis 10.0 Chr3:88744770..88744794 21/25 Antisense off-target snd1
Chr9:30245200..30245224 21/25 Sense off-target elfn1
Chr2:50139315..50139339 22/25 Antisense unknown
Chr2:23208227..23208251 21/25 Sense unknown
Publications
First: A vertebrate homolog of the cell cycle regulator Dbf4 is an inhibitor of Wnt signaling required for heart development., Dev Cell 2005    
Most recent:
View All Papers