Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249362

Morpholino Name: dbf4 MO1
Synonyms: XDMO2
Target mRNA: dbf4

Morpholino Type: uncategorized morpholino
Sequence: 5' CCATGTGTTCCTCGGTTTCTGTGCA 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:97504379..97504403 22/25 Antisense off-target LOC108716929
Chr8L:66457781..66457805 21/25 Antisense unknown
tropicalis 10.0 Chr3:29094859..29094883 21/25 Sense unknown
Publications
First: A vertebrate homolog of the cell cycle regulator Dbf4 is an inhibitor of Wnt signaling required for heart development., Dev Cell 2005    
Most recent:
View All Papers