Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249361

Morpholino Name: dazap2 MO2
Synonyms: SP-MO
Target mRNA: dazap2

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTACTGTCCTGTAGAAAGGAAAGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 23/25
genome
MO
5' GCTTTCCTTTCTACAGGACAGTACC 3'
   |||||||||||||||||||||||||
3' CGAAAGGAAAGATGTCCTGTCATGG 5'
5' GCTTTCTTTTCTACAGGACAATACC 3'
   |||||| ||||||||||||| ||||
3' CGAAAGGAAAGATGTCCTGTCATGG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:149940126..149940150 23/25 Antisense target dazap2.L
Chr9_10S:92389542..92389566 22/25 Sense off-target LOC121399085
Chr6L:152450495..152450519 21/25 Sense off-target LOC108719412
Chr1L:210135096..210135120 21/25 Sense unknown
tropicalis 10.0 Chr2:142307159..142307183 25/25 Antisense target dazap2
Publications
First: Dazap2 is required for FGF-mediated posterior neural patterning, independent of Wnt and Cdx function., Dev Biol 2009                                
Most recent:
View All Papers