Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249359

Morpholino Name: dand5 MO2
Synonyms: Coco2 MO
Target mRNA: dand5

Morpholino Type: uncategorized morpholino
Sequence: 5' TGGTGGCCTGGAACAGCAGCATGTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25 24/25
genome
MO
5' AACATGCTGCTGTTCCGGGCCGCCA 3'
    ||||||||||||||| |||| |||
3' CTGTACGACGACAAGGTCCGGTGGT 5'
5' GACATGCTGCTGTTCCAGGCCACCA 3'
   |||||||||||||||||||||||||
3' CTGTACGACGACAAGGTCCGGTGGT 5'
5' GACATGCTGTTGTTCCAGGCCACCA 3'
   ||||||||| |||||||||||||||
3' CTGTACGACGACAAGGTCCGGTGGT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:149280239..149280263 25/25 Sense target dand5.L
Chr3S:124818879..124818903 24/25 Sense target dand5.S
Chr4L:58103567..58103591 22/25 Sense off-target plcg2.L
tropicalis 10.0 Chr3:139673961..139673985 22/25 Sense target dand5
Publications
First: The left-right axis is regulated by the interplay of Coco, Xnr1 and derrière in Xenopus embryos., Dev Biol 2007                
Most recent: Leftward Flow Determines Laterality in Conjoined Twins., Curr Biol 2017                  
View All Papers