Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249357

Morpholino Name: dag1 MO3
Synonyms: Mo-X-DG
Target mRNA: dag1

Morpholino Type: uncategorized morpholino
Sequence: 5' TACAGCGTAGGAGGCAGCTTGTCT 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 23/24 21/24
genome
MO
5' AGACGAGCTGCCTCCTACGCTGTA 3'
   |||| |||||||||||||||||||
3' TCTGTTCGACGGAGGATGCGACAT 5'
5' AGACGCGTTGCCTCCTACGCTGTA 3'
   ||||  | ||||||||||||||||
3' TCTGTTCGACGGAGGATGCGACAT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:124438256..124438279 23/24 Antisense target dag1.L
Chr4S:104610221..104610244 21/24 Antisense target dag1.S
tropicalis 10.0 Chr1:145289212..145289235 21/24 Antisense off-target iqcd
Chr1:145289212..145289235 21/24 Antisense off-target tpcn1
Chr7:64513696..64513719 20/24 Sense off-target LOC101731286
Chr1:133629830..133629853 20/24 Antisense unknown
Publications
First: Dystroglycan is required for proper retinal layering., Dev Biol 2006              
Most recent:
View All Papers