Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249354

Morpholino Name: dact1 MO2
Synonyms: Frodo, Frodo morpholino
Target mRNA: dact1

Morpholino Type: uncategorized morpholino
Sequence: 5' ATGGGCTTCATCCTGGGACAGCGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 23/24 24/24
genome
MO
5' TCGCTGTCCCAGGATGAAGCCGAT 3'
   ||||||||||||||||||||| ||
3' AGCGACAGGGTCCTACTTCGGGTA 5'
5' TCGCTGTCCCAGGATGAAGCCCAT 3'
   ||||||||||||||||||||||||
3' AGCGACAGGGTCCTACTTCGGGTA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8S:7159521..7159544 24/24 Antisense target dact1.S
Chr6L:124844657..124844680 20/24 Sense unknown
tropicalis 10.0 Chr8:103323956..103323979 23/24 Sense target dact1
Chr3:95458060..95458083 20/24 Sense off-target sord
Chr9:89401293..89401316 20/24 Sense off-target clasp1
Publications
First: Frodo interacts with Dishevelled to transduce Wnt signals., Nat Cell Biol 2002  
Most recent: Delamination of neural crest cells requires transient and reversible Wnt inhibition mediated by Dact1/2., Development 2016            
View All Papers