Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249353

Morpholino Name: dact1 MO1
Synonyms: FrdMO, XDPR MO
Target mRNA: dact1

Morpholino Type: uncategorized morpholino
Sequence: 5' CAGGGGCGGCGGGGATCGGCTTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 24/25 25/25
genome
MO
5' ATGAAGCCGATCCCCGCCACCCCTG 3'
   |||||||||||||||||| ||||||
3' TACTTCGGCTAGGGGCGGCGGGGAC 5'
5' ATGAAGCCGATCCCCGCCGCCCCTG 3'
   |||||||||||||||||||||||||
3' TACTTCGGCTAGGGGCGGCGGGGAC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:94779197..94779221 25/25 Sense target dact1.L
Chr1L:188824439..188824463 22/25 Antisense off-target man2a1.L
tropicalis 10.0 Chr8:103323942..103323966 24/25 Sense target dact1
Publications
First: Dapper, a Dishevelled-associated antagonist of beta-catenin and JNK signaling, is required for notochord formation., Dev Cell 2002    
Most recent: The involvement of Frodo in TCF-dependent signaling and neural tissue development., Development 2004        
View All Papers