Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249350

Morpholino Name: daam1 MO1
Synonyms: daam1 MO
Target mRNA: daam1

Morpholino Type: uncategorized morpholino
Sequence: 5' GCCGCAGGTCTGTCAGTTGCTTCTA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 22/25
genome
MO
5' TAAAAGCAACTGACAGACCTGTGGC 3'
   || |||||||||||||||||| |||
3' ATCTTCGTTGACTGTCTGGACGCCG 5'
5' TAGAAGCAACTGACAGACCTGCGGC 3'
   |||||||||||||||||||||||||
3' ATCTTCGTTGACTGTCTGGACGCCG 5'
5' TGAAAGCAACTGACAGACCTGTGGC 3'
   |  |||||||||||||||||| |||
3' ATCTTCGTTGACTGTCTGGACGCCG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:94455642..94455666 25/25 Sense target daam1.L
Chr8S:7411562..7411586 22/25 Antisense target daam1.S
Chr3L:32209902..32209926 21/25 Antisense unknown
Chr5S:80978698..80978722 21/25 Antisense unknown
tropicalis 10.0 Chr8:103047466..103047490 23/25 Sense target daam1
Chr6:23265625..23265649 21/25 Antisense unknown
Publications
First: Wnt/Frizzled activation of Rho regulates vertebrate gastrulation and requires a novel Formin homology protein Daam1., Cell 2001    
Most recent: The Wnt/PCP formin Daam1 drives cell-cell adhesion during nephron development., Cell Rep 2021                                                        
View All Papers