Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249272

Morpholino Name: cdknx MO2
Synonyms:
Target mRNA: cdknx

Morpholino Type: uncategorized morpholino
Sequence: 5' GCAGGGCGATGTGGAAGGCAGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 24/25
genome
MO
5' ATGGCTGCCTTCCACATCGCCCTGC 3'
   |||||||||||||||||||||||||
3' TACCGACGGAAGGTGTAGCGGGACG 5'
5' ATGGCTGCTTTCCACATCGCCCTGC 3'
   |||||||| ||||||||||||||||
3' TACCGACGGAAGGTGTAGCGGGACG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:123776903..123776927 24/25 Antisense target cdknx.L
Chr7S:103229181..103229205 24/25 Antisense off-target xicl
Chr7L:86841440..86841464 21/25 Sense off-target LOC121395553
tropicalis 10.0 Chr7:117636674..117636698 25/25 Antisense target cdknx
Publications
First: Depletion of the cell-cycle inhibitor p27(Xic1) impairs neuronal differentiation and increases the number of ElrC(+) progenitor cells in Xenopus tropicalis., Mech Dev 2003              
Most recent:
View All Papers