Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249271

Morpholino Name: cdknx MO1
Synonyms: Xic1 MO, p27Xic1, p27Xic1 MO
Target mRNA: cdknx

Morpholino Type: uncategorized morpholino
Sequence: 5' GCAGGGCGATGTGGAAAGCAGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 24/25 25/25
genome
MO
5' ATGGCTGCCTTCCACATCGCCCTGC 3'
   |||||||| ||||||||||||||||
3' TACCGACGAAAGGTGTAGCGGGACG 5'
5' ATGGCTGCTTTCCACATCGCCCTGC 3'
   |||||||||||||||||||||||||
3' TACCGACGAAAGGTGTAGCGGGACG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:123776903..123776927 25/25 Antisense target cdknx.L
Chr7S:103229181..103229205 25/25 Antisense off-target xicl
Chr2S:95255517..95255541 21/25 Sense unknown
tropicalis 10.0 Chr7:117636674..117636698 24/25 Antisense target cdknx
Chr7:83224243..83224267 21/25 Antisense off-target cadm1
Publications
First: The cdk inhibitor p27Xic1 is required for differentiation of primary neurones in Xenopus., Development 2003            
Most recent: Ascl1 phospho-status regulates neuronal differentiation in a Xenopus developmental model of neuroblastoma., Dis Model Mech 2015                  
View All Papers