Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249219

Morpholino Name: bves MO1
Synonyms: Bves MO, Xbves MO
Target mRNA: bves

Morpholino Type: uncategorized morpholino
Sequence: 5' ATCTTTCTTATACCTGGATGTGCAG 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8S:42470262..42470286 22/25 Sense off-target crb2.S
Chr3S:64292618..64292642 22/25 Sense unknown
Chr1S:114765047..114765071 21/25 Antisense unknown
Chr2L:42448668..42448692 21/25 Antisense unknown
Chr5L:69435481..69435505 21/25 Antisense unknown
Chr6L:163597609..163597633 21/25 Antisense unknown
tropicalis 10.0 Chr4:81342311..81342335 21/25 Sense off-target erich3
Chr4:64000358..64000382 21/25 Sense unknown
Publications
First: Xbves is a regulator of epithelial movement during early Xenopus laevis development., Proc Natl Acad Sci U S A 2006      
Most recent: Identification of a novel Bves function: regulation of vesicular transport., EMBO J 2010  
View All Papers