Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250470

Morpholino Name: tcf3 MO1
Synonyms: e2a MO
Target mRNA: tcf3

Morpholino Type: uncategorized morpholino
Sequence: 5' TGTCATCCTCTGCTGTTGATTCATT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 23/25
genome
MO
5' AATGAATCAACAGCAGAGGATGACA 3'
   |||||||||||||||||||||||||
3' TTACTTAGTTGTCGTCTCCTACTGT 5'
5' AATGAATCAGCAGCAGAGGATGACA 3'
   ||||||||| |||||||||||||||
3' TTACTTAGTTGTCGTCTCCTACTGT 5'
5' AATGAATCAGCAGCAGAGGATCACA 3'
   ||||||||| ||||||||||| |||
3' TTACTTAGTTGTCGTCTCCTACTGT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:107215178..107215202 24/25 Antisense target tcf3.L
Chr1S:88957154..88957178 23/25 Antisense target tcf3.S
Chr9_10L:33710712..33710736 21/25 Sense off-target LOC108701018
Chr1L:142479104..142479128 21/25 Sense unknown
tropicalis 10.0 Chr1:98622610..98622634 25/25 Antisense target tcf3
Chr2:57815827..57815851 21/25 Sense off-target LOC116408821
Chr6:141402989..141403013 21/25 Sense unknown
Publications
First: HEB and E2A function as SMAD/FOXH1 cofactors., Genes Dev 2011              
Most recent: Morpholinos Do Not Elicit an Innate Immune Response during Early Xenopus Embryogenesis., Dev Cell 2019          
View All Papers