Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18374224

Morpholino Name: foxn4 MO1
Synonyms:
Target mRNA: foxn4

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CCTAAATGTCCCAGGCGTAGGTCTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' GAGACCTACGCCTGGGACATTTAGG 3'
   |||||||||||||||||||||||||
3' CTCTGGATGCGGACCCTGTAAATCC 5'
5' GAGACCTACGCCTGGGACATTTAGG 3'
   |||||||||||||||||||||||||
3' CTCTGGATGCGGACCCTGTAAATCC 5'
5' GAGACCTACGCCTGGGACATTTAGG 3'
   |||||||||||||||||||||||||
3' CTCTGGATGCGGACCCTGTAAATCC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:158855219..158855243 25/25 Sense target foxn4.L
Chr1S:135527460..135527484 25/25 Sense target foxn4.S
tropicalis 10.0 Chr1:146687701..146687725 25/25 Sense target foxn4
Publications
First: Foxn4 promotes gene expression required for the formation of multiple motile cilia., Development 2016                                    
Most recent: Morpholinos Do Not Elicit an Innate Immune Response during Early Xenopus Embryogenesis., Dev Cell 2019          
View All Papers