Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18396964

Morpholino Name: tbxt.2 MO4
Synonyms: t2 MO, t2 MOsplice
Target mRNA: tbxt.2

Morpholino Type: splice blocking morpholino
Sequence: 5' GAAAGGTCCATATTCTCTTACCTTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 25/25
genome
MO
5' GAAGGTAAGAGAATATGGACCTTTC 3'
   |||||||||||||||||||||||||
3' CTTCCATTCTCTTATACCTGGAAAG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:70926523..70926547 21/25 Antisense off-target ntm.L
Chr5S:7242855..7242879 21/25 Antisense off-target kcnk5.S
tropicalis 10.0 Chr5:55097904..55097928 25/25 Sense target tbxt.2
Chr5:2949208..2949232 21/25 Antisense off-target kcnk5
Publications
First: In vivo T-box transcription factor profiling reveals joint regulation of embryonic neuromesodermal bipotency., Cell Rep 2013                                
Most recent: The Spatiotemporal Control of Zygotic Genome Activation., iScience 2019                            
View All Papers