Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17310770

Morpholino Name: tbxt.2 MO3
Synonyms: Bra3, TNeu061i04, Xbra3 MO2, XtBra3
Target mRNA: tbxt.2

Morpholino Type: uncategorized morpholino
Sequence: 5' AGCTGTGCCTGTGCTCATTGTATTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 25/25 23/25
genome
MO
5' CAATACAATGAGCACAGGCACAGCT 3'
   |||||||||||||||||||||||||
3' GTTATGTTACTCGTGTCCGTGTCGA 5'
5' CAATACTATGAGTACAGGCACAGCT 3'
   |||||| ||||| ||||||||||||
3' GTTATGTTACTCGTGTCCGTGTCGA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:57376166..57376190 23/25 Sense target tbxt.2.S
Chr5S:22011730..22011754 22/25 Antisense off-target LOC108717536
Chr5S:46781226..46781250 22/25 Sense off-target LOC108717871
Chr5S:60129315..60129339 21/25 Antisense unknown
tropicalis 10.0 Chr5:55098113..55098137 25/25 Sense target tbxt.2
Chr8:11430758..11430782 21/25 Sense off-target tsc1
Chr1:171233598..171233622 21/25 Sense unknown
Chr7:64613500..64613524 21/25 Antisense unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent: The Spatiotemporal Control of Zygotic Genome Activation., iScience 2019                            
View All Papers