Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17310768

Morpholino Name: tbxt MO3
Synonyms: TGas116l23, Xbra MO2, Xtbra.2
Target mRNA: tbxt

Morpholino Type: translation blocking morpholino
Sequence: 5' GGCTTCCAAGCGCACACACTGGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 23/23
genome
MO
5' CCCAGTGTGTGCGCTTGGAAGCC 3'
   |||||||||||||||||||||||
3' GGGTCACACACGCGAACCTTCGG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:28252823..28252845 19/23 Antisense off-target mid2.L
Chr8S:72224827..72224849 19/23 Antisense unknown
Chr9_10L:31200821..31200843 19/23 Sense unknown
tropicalis 10.0 Chr5:55135471..55135493 23/23 Sense target tbxt
Chr6:49880565..49880587 21/23 Sense off-target osbpl10
Chr8:107311147..107311169 20/23 Sense unknown
Chr3:142553241..142553263 19/23 Sense unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent: The Spatiotemporal Control of Zygotic Genome Activation., iScience 2019                            
View All Papers