Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17310767

Morpholino Name: tbxt MO2
Synonyms: Xbra MO1
Target mRNA: tbxt

Morpholino Type: splice blocking morpholino
Sequence: 5' TGGAGAGACCCTGATCTTACCTTCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 25/25
genome
MO
5' GGAAGGTAAGATCAGGGTCTCTCCA 3'
   |||||||||||||||||||||||||
3' CCTTCCATTCTAGTCCCAGAGAGGT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
tropicalis 10.0 Chr5:55135232..55135256 25/25 Sense target tbxt
Publications
First: In vivo T-box transcription factor profiling reveals joint regulation of embryonic neuromesodermal bipotency., Cell Rep 2013                                
Most recent: The Spatiotemporal Control of Zygotic Genome Activation., iScience 2019                            
View All Papers