Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18374355

Morpholino Name: ascl1 mismatch cMO2
Synonyms:
Target mRNA: ascl1

Morpholino Type: control morpholino (ATG)
Sequence: 5' CACTTCTCCATCCTCACACGCT 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:160030444..160030465 19/22 Antisense off-target chrnb1.L
Chr4S:117626169..117626190 18/22 Antisense off-target il17re.S
Chr5L:148419796..148419817 18/22 Antisense off-target LOC108717172
Chr8L:98205251..98205272 19/22 Sense unknown
Chr9_10S:1608221..1608242 19/22 Antisense unknown
Chr3L:4951583..4951604 18/22 Antisense unknown
tropicalis 10.0 Chr3:101377506..101377527 18/22 Antisense off-target wdr72
Publications
First:
Most recent:
View All Papers