Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18374354

Morpholino Name: ascl1 mismatch cMO1
Synonyms:
Target mRNA: ascl1

Morpholino Type: control morpholino (ATG)
Sequence: 5' AGTATCCATACTAATAGGCTAATAAT 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
Publications
First:
Most recent:
View All Papers