Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18374353

Morpholino Name: ascl1 MO4
Synonyms: Ascl1b MOb
Target mRNA: ascl1

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GTCTCCATGCTGATAGGCTGATGAT 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' ATCATCAGCCTATCAGCATGGAGAC 3'
   |||||||||||||||||||||||||
3' TAGTAGTCGGATAGTCGTACCTCTG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:97599656..97599680 25/25 Antisense target ascl1.S
Chr9_10L:14718847..14718871 21/25 Sense off-target rbbp8nl.L
Chr9_10S:55780349..55780373 21/25 Sense unknown
tropicalis 10.0 Chr2:57424258..57424282 21/25 Sense unknown
Chr4:99669413..99669437 21/25 Sense unknown
Publications
First: A novel role for Ascl1 in the regulation of mesendoderm formation via HDAC-dependent antagonism of VegT., Development 2016                              
Most recent: Morpholinos Do Not Elicit an Innate Immune Response during Early Xenopus Embryogenesis., Dev Cell 2019          
View All Papers