Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18374352

Morpholino Name: ascl1 MO3
Synonyms:
Target mRNA: ascl1

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CAGTTGTCCATGCTGACAGGCTGCT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' AGCAGCCTGTCAGCATGGACAACTG 3'
   |||||||||||||||||||||||||
3' TCGTCGGACAGTCGTACCTGTTGAC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:57040599..57040623 25/25 Sense target ascl1.L
Chr6L:89410667..89410691 21/25 Antisense off-target cdh20.L
Publications
First: A novel role for Ascl1 in the regulation of mesendoderm formation via HDAC-dependent antagonism of VegT., Development 2016                              
Most recent: Morpholinos Do Not Elicit an Innate Immune Response during Early Xenopus Embryogenesis., Dev Cell 2019          
View All Papers