Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250234

Morpholino Name: rfx2 MO1
Synonyms: Rfx2, Rfx2 MO
Target mRNA: rfx2

Morpholino Type: uncategorized morpholino
Sequence: 5' AATTCTGCATACTGGTTTCTCCGTC 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 21/25
genome
MO
5' TTCACAGAAACCAGTATGCAGAATT 3'
     |  ||||||||||||||||||||
3' CTGCCTCTTTGGTCATACGTCTTAA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1S:92619593..92619617 21/25 Sense target rfx2.S
Chr1L:111026111..111026135 21/25 Sense off-target LOC108712768
Chr9_10L:132352690..132352714 21/25 Antisense off-target LOC121398142
tropicalis 10.0 Chr5:58384517..58384541 21/25 Antisense off-target slc35d3
Chr3:130119587..130119611 21/25 Sense off-target rhobtb2
Chr3:68596958..68596982 21/25 Antisense off-target cttnbp2
Publications
First: RFX2 is broadly required for ciliogenesis during vertebrate development., Dev Biol 2012                                                            
Most recent: Morpholinos Do Not Elicit an Innate Immune Response during Early Xenopus Embryogenesis., Dev Cell 2019          
View All Papers