Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-25918746

Morpholino Name: tcf21 cMO1
Synonyms:
Target mRNA: tcf21

Morpholino Type: control morpholino
Sequence: 5' GATGAACGTCTGACTCAATCCAATA 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
tropicalis 10.0 Chr8:92662151..92662175 21/25 Antisense off-target fancm
Publications
First:
Most recent:
View All Papers