Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18374358

Morpholino Name: tcf21 MO4
Synonyms:
Target mRNA: tcf21

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' GATCAAGGTGTGACTGAATGCAATA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25 24/25
genome
MO
5' TGTTGTATTCAGTCACACCTTGGTC 3'
   | ||| |||||||||||||||| ||
3' ATAACGTAAGTCAGTGTGGAACTAG 5'
5' TATTGCATTCAGTCACACCTTGATC 3'
   |||||||||||||||||||||||||
3' ATAACGTAAGTCAGTGTGGAACTAG 5'
5' TATTGCACTCAGTCACACCTTGATC 3'
   ||||||| |||||||||||||||||
3' ATAACGTAAGTCAGTGTGGAACTAG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:73949558..73949582 25/25 Antisense target tcf21.L
Chr5S:62069874..62069898 24/25 Sense target tcf21.S
Chr4L:52701760..52701784 21/25 Sense unknown
tropicalis 10.0 Chr5:71125533..71125557 22/25 Antisense target tcf21
Chr2:135641134..135641158 22/25 Sense unknown
Publications
First: Tcf21 regulates the specification and maturation of proepicardial cells., Development 2013                                  
Most recent: Morpholinos Do Not Elicit an Innate Immune Response during Early Xenopus Embryogenesis., Dev Cell 2019          
View All Papers