|
XB-ANTIBODY-14586629
|
Antibody Name:
Pum1 Ab2
Common Name: Pumilio RRID: Synonyms: xPum NC
Source: |
|
| Antibody | |
| Clone Number | |
| Purification | |
| Isotype | IgG |
| Host Organism | mouse |
| Xenopus Reactivity | X. tropicalis, X. laevis |
| Non-Xenopus Reactivity | |
| Description: | generated by Yamashita Lab |
| Immunogen | |
| Name | xPum |
| Type | polypeptide |
| Post Translational Modifications | None |
| Source Organism | frog |
| Description | AA coded between AAGGATCCGCCGCGCATCAGCAACACATA and AAACTCGAGAGAGGGCATGACATCTGACATon the N-terminus of Xenopus Pumilio |
| Sequence | |
| Reported Usage | |
| western blot | |
| Publications | |
| First: |
Involvement of Xenopus Pumilio in the translational regulation that is specific to cyclin B1 mRNA during oocyte maturation., Mech Dev 2003 |
| Most recent: | |
| View All Papers | |