Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions
XB-CLONE-1630514

Clone Name: angptl2-883 Gene: angptl2.S , angptl2.L Species: Xenopus laevis  
Description: EXRC Clone Number 883. Clone previously called: IMAGE:8076172

Sequence:

Full length sequence: BC124875 [+]

5' EST: DT068772 [+]

3' EST: DT068648 [+]

Library:

Name: NICHD_XGC_FaBNExternal Dbs: Unigene laevis cDNA library, Xenopus IMAGE cDNA Library

Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.2kb resulted in an average insert size of 1.5kb, and Cot value of 7. This is a normalized library (primary library is NICHD_XGC_FaB) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.

Anatomy: fat bodyStage:
Normalized: NoSubtraction: No

Vector DetailsVector Map
Name: pExpress-1

Type: plasmid

5' Restriction Site: EcoRV

3' Restriction Site: NotI		Expression Image

Usage:

Whole mount in situ hybridization:  
 
Probes:
Type Size Promoter Linearization Site Description
antisense T7 SmaI

Suppliers:

Search for clone at: EXRC