|
XB-CLONE-1802813
Clone Name: IMAGE:7207011 | Gene: rflcii.L | Species: Xenopus laevis | |
Sequence:
3' EST: CN328874 [+]
Library:
Name: NICHD_XGC_Te2 | External Dbs: Unigene laevis cDNA library, Xenopus IMAGE cDNA Library |
Description: RNA obtained from 6 adult male testes. cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1kb resulted in an average insert size of 1.25 kb. This is a primary library (normalized primary library is NICHD_XGC_Te2N) and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.
Anatomy: testis | Stage: |
Normalized: No | Subtraction: No |
Vector Details | Vector Map | Name: pExpress-1 Type: plasmid 5' Restriction Site: EcoRV 3' Restriction Site: NotI |
Usage:
Suppliers:
Search for clone at: Open Biosystems