Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Return to miRNA Table
miRNA Name: xtr-miR-181a
Mature Sequence: AACAUUCAACGCUGUCGGUGAGU
Full Sequence:
miRBase:
In Situ Images:

NF Stage 18

NF Stage 22

NF Stage 29

Cited Literature:
Stage-specific expression of microRNAs during Xenopus development.
Watanabe T et al. 2005
miR-31 functions as a negative regulator of lymphatic vascular lineage-specific differentiation in vitro and vascular development in vivo.
Karpanen T et al. 2010
Xenopus microRNA genes are predominantly located within introns and are differentially expressed in adult frog tissues via post-transcriptional regulation.
Tang GQ et al. 2008